5′- CCGTTGGTGTATCTTTGAATA -3′
Recent Posts
- ssAAV9-CMV-SecNanoLuc & scAAV9-CMV-SecNanoLuc, Ready to Package
- AAV(BI30)-CAG-GFP-3xmiR122 is Ready to Package for the Transduction of the Endothelial Cells of CNS
- AAV(9-X1.1)-CMV-GFP is Ready to Package for the Transduction of the Endothelial Cells of CNS
- The Principle of Transformation
- IRES or 2A in my polycistronic expression cassette, which one is better?
- AAV[MyoAAV(2A)]-CMV-GFP and AAV[MyoAAV(4E)]-CMV-GFP Ready to Package
- How Orbital Diameter and Shaker Agitation Rate Affect Bacteria Growth
- scAAV(Ark313)-CBh-GFP Ready to Package for Optimal Mouse T Cell Transduction
- AAV(MG1.1)-CMV-GFP and AAV(MG1.2)-CMV-GFP Ready to Package for Microglia Transduction
- Gibson Assembly Cloning
- Tips for Maximizing Ligation Efficiencies
- Troubles with ligation?
- Electroporation Tips
- Electroporation vs. Heat Shock Transformation
- Causes and Solutions for Bad qPCR Efficiency
- Lentivirus Formulation Buffer
- A195 Buffer for Adenovirus Formulation and Long Term Storage
- DNA/RNA non-specific endonuclease [Serratia marcescens]
- DNA/RNA non-specific endonuclease [Serratia marcescens]
- DNA/RNA non-specific endonuclease [Serratia marcescens]
- Starting Materials to Run a ddPCR for rAAV Titration with An AutoDG Droplet Generator and QX 200 Droplet Reader
- Tips and tricks for performing ddPCR
- LV-EF1a-GFP-Puro in Baboon Envelope Pseudotype, Ready to Package
- Adenovirus Type C qPCR Titration Primers and Probe
- Density and Refractive Index for CsCl
- Cell Culture Antibiotic Selection Guide
- AAV5-RPhpe427-GFP and AAV5-RPhpe1289-GFP Ready to Package
- DOS & DON’TS OF PLASMID PURIFICATION
- AAV9-hSyn-hM3D(Gq)-mCherry and AAV9-hSyn-hM4D(Gi)-mCherry Ready to Package
- Membrane Information
- Quantification of AAV particles and empty capsids by optical density measurement
- qPCR Determination of Mycoplasma in AAV Samples
- AAV10 VP1 Sequence
- Validated Target Region against Human HSD17B13 Gene
- Validated Target Region for TLR4 Gene
- Mouse EGR1 Validated Target Region