5′- CCGTTGGTGTATCTTTGAATA -3′
Recent Posts
- scAAV(Ark313)-CMV-GFP Ready to Package for Optimal Mouse T Cell Transduction
- AAV(MG1.1)-CMV-GFP and AAV(MG1.2)-CMV-GFP Ready to Package for Microglia Transduction
- Gibson Assembly Cloning
- Tips for Maximizing Ligation Efficiencies
- Troubles with ligation?
- Electroporation Tips
- Electroporation vs. Heat Shock Transformation
- Causes and Solutions for Bad qPCR Efficiency
- Lentivirus Formulation Buffer
- A195 Buffer for Adenovirus Formulation and Long Term Storage
- DNA/RNA non-specific endonuclease [Serratia marcescens]
- DNA/RNA non-specific endonuclease [Serratia marcescens]
- DNA/RNA non-specific endonuclease [Serratia marcescens]
- Starting Materials to Run a ddPCR for rAAV Titration with An AutoDG Droplet Generator and QX 200 Droplet Reader
- Tips and tricks for performing ddPCR
- LV-EF1a-GFP-Puro in Baboon Envelope Pseudotype, Ready to Package
- Adenovirus Type C qPCR Titration Primers and Probe
- Density and Refractive Index for CsCl
- Cell Culture Antibiotic Selection Guide
- AAV5-RPhpe427-GFP and AAV5-RPhpe1289-GFP Ready to Package
- DOS & DON’TS OF PLASMID PURIFICATION
- AAV9-hSyn-hM3D(Gq)-mCherry and AAV9-hSyn-hM4D(Gi)-mCherry Ready to Package
- Membrane Information
- Quantification of AAV particles and empty capsids by optical density measurement
- qPCR Determination of Mycoplasma in AAV Samples
- AAV10 VP1 Sequence
- Validated Target Region against Human HSD17B13 Gene
- Validated Target Region for TLR4 Gene
- Mouse EGR1 Validated Target Region
- Human ChAT Promoter
- Validated Target Region against Mouse G3BP Gene
- Two Validated Mouse SV2C Target Regions
- Validated Target Region against Mouse Cacna1c Gene
- Luna Universal Probe One-Step RT-qPCR for Detection of Covid-19
- RT-qPCR Reaction Conditions for Detection of Covid-19 by FDA and CDC
- AAV8-GFAP0.7-emGFP-miRNA(mPTBP1) Ready to Package