agcagtgatgtcataatgatgtaatgcttattgtcacgcgatagttaatgattaacagtcatgtgatgtgttttatccaataggaagaaagcgcgcgtatgagttctcgcgagacttccggggtataaaagaccgagtgaacgagcccgccgccattctttgctctggactgctagaggaccctcgctgcc
All posts by signagen
AAV5 P41 vs AAV2 P40 Promoters
The P41 and 40 promoters are the capsid gene promoters of different Adeno-Associated Virus (AAV) serotypes, driving the expression of the structural viral proteins (VP1, VP2, VP3). They exhibit key […]
Cis-Acting Elements and Trans-Acting Factors on AAV2 Promoters
The three promoters are functionally interconnected through their shared regulatory elements, leading to the coordinated but hierarchical expression of AAV’s replication (Rep) and capsid (Cap) genes. Promoter Cis-Acting Elements (Key […]
Strength of AAV P5, P19 and P40 Promoters in Serotype 2
The AAV serotype 2 promoters P5, P19, and P40 exhibit a distinct hierarchy of strength during a productive lytic infection (i.e., in the presence of a helper virus like adenovirus, […]
What is the Linear Range of RLU for an Luminometer?
1. Typical linear ranges 2. How to determine linear range experimentally 3. Practical notes
TetR vs rTetR
TetR (Tetracycline Repressor) rTetR (reverse TetR) Summary Table Feature TetR rTetR (reverse TetR) Binds tetO (no doxycycline) Yes No Binds tetO (with doxycycline) No Yes Gene expression (no doxycycline) OFF […]
Role of MAAP in rAAV Biology & Production
Here’s the role of MAAP in rAAV biology and production: