Skip to content

All posts by signagen

DNA/RNA non-specific endonuclease [Serratia marcescens]

atgcgctttaacaacaagatgttggccctggccgccctgctgttcgccgcacaggcgtcggccgacacgttcgaatccatcgacaactgcgcggtcggctgcccgaccggcggcagcagcaacgtgtcgatcgtgcgtcatgcttatacgttgaacaacaacagcacaaccaagttcgccaactgggtggcctatcacatcaccaaagacacgccggccagcggcaagacgcgcaactggaaaaccgacccggcgctcaatccggccgacaccctggcgcccgccgattacaccggcgccaacgcggcgctgaaggtcgatcgcggtcatcaggcgccgctggcctcgctggcgggcgtttccgactgggaatcgctgaactacctgtccaacatcacgccgcaaaagtccgatcttaaccagggcgcctgggcgcggctggaagatcaggaacgcaagctgatcgatcgcgccgacatctcctcggtctataccgtgaccgggccgttgtatgagcgtgatatgggcaaactgccgggcacccagaaagcgcacaccatccccagcgcctactggaaggtgattttcatcaacaacagcccggcggtaaaccactatgccgctttcctgttcgatcagaacacgccgaagggcgccgatttctgccaattccgcgtgacggtggacgagatcgagaaacgtaccggcctgatcatctgggccggtctgccggacgacgtacaggcttcgctgaagagcaagcccggcgtcctgccggagctgatgggctgcaaaaactga

DNA/RNA non-specific endonuclease [Serratia marcescens]

ATGCGCTTCTCCAACAAAATGCTTGCGTTGGCAGCACTGCTGTTTGCAGCGCAAGCGAGTGCAGATACCCTGGAGTCGATTGACAATTGTGCTGTGGGTTGTCCGACAGGAGGCAGCAGTAACGTGAGCATCGTACGTCATGCGTATACCCTGAACAACAATAGCACCACCAAATTTGCGAATTGGGTGGCGTACCATATTACGAAGGACACGCCGGCCTCTGGGAAAACCCGGAATTGGAAAACCGATCCCGCGCTGAATCCGGCCGATACTCTGGCACCAGCCGACTATACAGGCGCGAATGCTGCTCTGAAAGTGGATCGTGGGCATCAAGCCCCTTTAGCGTCACTTGCCGGCGTTTCTGACTGGGAATCGCTCAACTATCTCAGCAACATTACGCCGCAGAAATCTGACCTTAACCAGGGTGCATGGGCACGCTTGGAAGATCAGGAACGCAAGCTGATTGATCGTGCGGACATTTCATCCGTCTACACCGTTACTGGTCCGCTGTATGAACGCGATATGGGCAAATTACCGGGCACGCAGAAAGCGCACACGATTCCCAGTGCTTACTGGAAAGTGATCTTCATCAACAATTCGCCTGCGGTCAACCACTATGCTGCGTTCCTGTTCGATCAGAACACGCCAAAAGGTGCCGACTTTTGCCAGTTTCGCGTAACCGTAGATGAAATCGAGAAACGTACCGGCCTGATCATCTGGGCCGGTTTACCGGATGATGTGCAGGCATCCTTGAAAAGCAAACCGGGCGTTCTGCCAGAACTGATGGGTTGCAAGAATTAA

DNA/RNA non-specific endonuclease [Serratia marcescens]

1 MRFNNKMLAL AALLFAAQAS ADTLESIDNC AVGCPTGGSS NVSIVRHAYT LNNNSTTKFA 61 NWVAYHITKD TPASGKTRNW KTDPALNPAD TLAPADYTGA NAALKVDRGH QAPLASLAGV 121 SDWESLNYLS NITPQKSDLN QGAWARLEDQ ERKLIDRADI SSVYTVTGPL YERDMGKLPG 181 TQKAHTIPSA YWKVIFINNS PAVNHYAAFL FDQNTPKGAD FCQFRVTVDE IEKRTGLIIW 241 AGLPDDIQAS […]

Tips and tricks for performing ddPCR

Clean everything You must have a clean working area to titer your AAV by ddPCR. Droplet digital PCR is a sensitive assay, so cross contamination into a no template control […]