Skip to content

Miscellaneous

Tips for Maximizing Ligation Efficiencies

T4 DNA Ligase is the most extensively used ligase for cloning-based experiments. Traditionally, a ligation reaction (blunt or cohesive ends) using traditional T4 DNA Ligase involves incubation at 16°C using […]

Troubles with ligation?

Check the activity of your T4 DNA Ligase with two easy-to-do control experiments You may check the efficiency of your ligation reaction by mixing the reaction with loading dye containing […]

Electroporation vs. Heat Shock Transformation

The advantages of using electroporation are the higher efficiency, more colonies, and much faster transformations compared to heat shock method. Transformation efficiencies for electroporation are 5.0 x 109 – 2.0 x […]

DNA/RNA non-specific endonuclease [Serratia marcescens]

atgcgctttaacaacaagatgttggccctggccgccctgctgttcgccgcacaggcgtcggccgacacgttcgaatccatcgacaactgcgcggtcggctgcccgaccggcggcagcagcaacgtgtcgatcgtgcgtcatgcttatacgttgaacaacaacagcacaaccaagttcgccaactgggtggcctatcacatcaccaaagacacgccggccagcggcaagacgcgcaactggaaaaccgacccggcgctcaatccggccgacaccctggcgcccgccgattacaccggcgccaacgcggcgctgaaggtcgatcgcggtcatcaggcgccgctggcctcgctggcgggcgtttccgactgggaatcgctgaactacctgtccaacatcacgccgcaaaagtccgatcttaaccagggcgcctgggcgcggctggaagatcaggaacgcaagctgatcgatcgcgccgacatctcctcggtctataccgtgaccgggccgttgtatgagcgtgatatgggcaaactgccgggcacccagaaagcgcacaccatccccagcgcctactggaaggtgattttcatcaacaacagcccggcggtaaaccactatgccgctttcctgttcgatcagaacacgccgaagggcgccgatttctgccaattccgcgtgacggtggacgagatcgagaaacgtaccggcctgatcatctgggccggtctgccggacgacgtacaggcttcgctgaagagcaagcccggcgtcctgccggagctgatgggctgcaaaaactga

DNA/RNA non-specific endonuclease [Serratia marcescens]

ATGCGCTTCTCCAACAAAATGCTTGCGTTGGCAGCACTGCTGTTTGCAGCGCAAGCGAGTGCAGATACCCTGGAGTCGATTGACAATTGTGCTGTGGGTTGTCCGACAGGAGGCAGCAGTAACGTGAGCATCGTACGTCATGCGTATACCCTGAACAACAATAGCACCACCAAATTTGCGAATTGGGTGGCGTACCATATTACGAAGGACACGCCGGCCTCTGGGAAAACCCGGAATTGGAAAACCGATCCCGCGCTGAATCCGGCCGATACTCTGGCACCAGCCGACTATACAGGCGCGAATGCTGCTCTGAAAGTGGATCGTGGGCATCAAGCCCCTTTAGCGTCACTTGCCGGCGTTTCTGACTGGGAATCGCTCAACTATCTCAGCAACATTACGCCGCAGAAATCTGACCTTAACCAGGGTGCATGGGCACGCTTGGAAGATCAGGAACGCAAGCTGATTGATCGTGCGGACATTTCATCCGTCTACACCGTTACTGGTCCGCTGTATGAACGCGATATGGGCAAATTACCGGGCACGCAGAAAGCGCACACGATTCCCAGTGCTTACTGGAAAGTGATCTTCATCAACAATTCGCCTGCGGTCAACCACTATGCTGCGTTCCTGTTCGATCAGAACACGCCAAAAGGTGCCGACTTTTGCCAGTTTCGCGTAACCGTAGATGAAATCGAGAAACGTACCGGCCTGATCATCTGGGCCGGTTTACCGGATGATGTGCAGGCATCCTTGAAAAGCAAACCGGGCGTTCTGCCAGAACTGATGGGTTGCAAGAATTAA

DNA/RNA non-specific endonuclease [Serratia marcescens]

1 MRFNNKMLAL AALLFAAQAS ADTLESIDNC AVGCPTGGSS NVSIVRHAYT LNNNSTTKFA 61 NWVAYHITKD TPASGKTRNW KTDPALNPAD TLAPADYTGA NAALKVDRGH QAPLASLAGV 121 SDWESLNYLS NITPQKSDLN QGAWARLEDQ ERKLIDRADI SSVYTVTGPL YERDMGKLPG 181 TQKAHTIPSA YWKVIFINNS PAVNHYAAFL FDQNTPKGAD FCQFRVTVDE IEKRTGLIIW 241 AGLPDDIQAS […]

Density and Refractive Index for CsCl

Density (g/cm^3)  Refractive index 1.0047 1.3333 1.0125 1.334 1.0204 1.3348 1.0284 1.3356 1.0365 1.3364 1.0447 1.3372 1.0531 1.338 1.0615 1.3388 1.07 1.3397 1.0788 1.3405 1.0877 1.3414 1.0967 1.3423 1.1059 1.3432 […]

Cell Culture Antibiotic Selection Guide

Product Name Gram (+)bacteria Gram (-)bacteria Yeasts Molds Mycoplasma Suggested Working Conc. Amphotericin B     † †   2.5 mg/L Amphotericin B-Solubilized (Approx. 45%)     † †   […]

DOS & DON’TS OF PLASMID PURIFICATION

Plasmid purification is a common technique in most molecular biology labs. While the standard alkaline lysis method had been well established, a surprising number of things still can go wrong. […]