For a 20µl reaction: Component Volume (µl) Final Concentration H2O 12.9 10x homemade core buffer 2 1x 2mM dNTP mix 2 0.2mM 20µM primer mix 0.5 500nM […]
Miscellaneous
Home made qPCR Master Mix
Reagent Volume (for 150 µL) qPCR mix (2×) 100 µL Sense primer (1 µM) 2 µL Antisense primer (1 µM) 2 µL Fluorescein (1 µM) 2 µL SYBR Green (40×) […]
The Principle of Transformation
As DNA is a highly hydrophilic molecule, it usually cannot pass through the cell membrane of bacteria. Hence, to make bacteria capable of internalizing genetic material, they must be made […]
How Orbital Diameter and Shaker Agitation Rate Affect Bacteria Growth
A common use for orbital shakers is to grow bacteria for a variety of purposes, including the production of proteins and genetic matter and for the study of bacteria themselves. […]
Gibson Assembly Cloning
Summary In 2009 Dr. Daniel Gibson and colleagues at the J. Craig Venter Institute developed a novel method for the easy assembly of multiple linear DNA fragments (Nat Methods 2009;6(5):343-5). […]
Tips for Maximizing Ligation Efficiencies
T4 DNA Ligase is the most extensively used ligase for cloning-based experiments. Traditionally, a ligation reaction (blunt or cohesive ends) using traditional T4 DNA Ligase involves incubation at 16°C using […]
Troubles with ligation?
Check the activity of your T4 DNA Ligase with two easy-to-do control experiments You may check the efficiency of your ligation reaction by mixing the reaction with loading dye containing […]
Electroporation vs. Heat Shock Transformation
The advantages of using electroporation are the higher efficiency, more colonies, and much faster transformations compared to heat shock method. Transformation efficiencies for electroporation are 5.0 x 109 – 2.0 x […]
DNA/RNA non-specific endonuclease [Serratia marcescens]
atgcgctttaacaacaagatgttggccctggccgccctgctgttcgccgcacaggcgtcggccgacacgttcgaatccatcgacaactgcgcggtcggctgcccgaccggcggcagcagcaacgtgtcgatcgtgcgtcatgcttatacgttgaacaacaacagcacaaccaagttcgccaactgggtggcctatcacatcaccaaagacacgccggccagcggcaagacgcgcaactggaaaaccgacccggcgctcaatccggccgacaccctggcgcccgccgattacaccggcgccaacgcggcgctgaaggtcgatcgcggtcatcaggcgccgctggcctcgctggcgggcgtttccgactgggaatcgctgaactacctgtccaacatcacgccgcaaaagtccgatcttaaccagggcgcctgggcgcggctggaagatcaggaacgcaagctgatcgatcgcgccgacatctcctcggtctataccgtgaccgggccgttgtatgagcgtgatatgggcaaactgccgggcacccagaaagcgcacaccatccccagcgcctactggaaggtgattttcatcaacaacagcccggcggtaaaccactatgccgctttcctgttcgatcagaacacgccgaagggcgccgatttctgccaattccgcgtgacggtggacgagatcgagaaacgtaccggcctgatcatctgggccggtctgccggacgacgtacaggcttcgctgaagagcaagcccggcgtcctgccggagctgatgggctgcaaaaactga