Skip to content

SignaGen’s In Vitro siRNA Transfection Reagents

siRNA Transfection Reagent Selection Chart. Reagents Features Transfection Type Toxicity PepMute™ – Exceptional good for siRNA transfection – OK for DNA/siRNA co-transfection siRNA (Yes) DNA/siRNA (No) ++ GenMute™ – Exceptional […]

>300 Pre-made Ready to Use Adenoviruses from SignaGen

SiganGen is offering >300 pre-made and ready to use adenovirus vectors.  All the pre-packaged adenoviruses were packaged from Ad.MAX™ system with a serotype 5 adenoviral backbone* (E1/E3 deletion).  All the […]

SignaGen’s rAAV Production Service

Multi Approaches to Produce Super Infectious rAAV Particles at Super High Titer: Not like adenovirus, it is relatively harder to achieve high yield of rAAV with regular rAAV production procedures. […]

SignaGen’s In Vitro DNA Transfection Reagents

Transfection Reagent Selection Chart. Reagents Features Transfection Type Toxicity* CalFectin™ – Traditional recipe with new formulation – Most affordable and efficient – Best for large scale virus, antibody and protein […]

One-step qRT-PCR for Lentivirus Titration

1. Extract RNA using a commercial kit 2. DNase treatment using RNase free DNase 1U/ul from Promega to digest residual plasmid DNA 3. Use ABI TaqMan One-Step RT-PCR master mix […]

qRT-PCR for Lentivirus Titration

1. Make two primer probe sets U5-Psi: U5-Psi forward: TGTGTGCCCGTCTGTTGTGT U5-Psi reverse: GAGTCCTGCGTCGAGAGAGC U5-Psi probe: FAM-CAGTGGCGCCCGAACAGGGA-TAMARA WPRE: WPRE forward: CCGTTGTCAGGCAACGTG WPRE reverse: AGCTGACAGGTGGTGGCAAT WPRE probe: FAMTGCTGACGCAACCCCCACTGGT-TAMARA 2. Purify RNA from […]

Concentrate Lentivirus by Ultra-centrifugation

Ultracentrifuge: Beckman LE 80K Rotor: SW28 Tubes: #326823 autoclaved (polyallomer) 1. Pool all viral media into and filter through a 0.45μm HV Durapore membrane (Millipore #SCHVU01RE). 2. Place tubes into […]

Lentivirus Purification by Ultra-centrifugation

Before Starting: Required equipments and consumbles: 1. SW-28 rotor with buckets and caps (Kept in 4C Refrigerator in Centrifuge Room) 2. SW-28 thin walled ultra clear centrifuge tubes (Beckman # […]

Formulation of Lipofectamine 2000 and Lipofectin

LIPOFECTIN is a 1:1 (w/w) mixture of N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA) and dioleoylphosphatidylethanolamine (DOPE). LIPOFECTAMINE is a 3:1 (w/w) mixture of the polycationic lipid, 2,3-dioleyloxy-N-[2(sperminecarboxamido)ethyl]-N,N-dimethyl-1-propanaminium trifluoroacetate (DOSPA), and DOPE.