Skip to content

Home-made Gateway Clonase II

1.Excision reaction. 44.5 mM Tris–borate (pH 8.3) 7.5 mM Tris–HCl (pH 8.0) 1.15 mM EDTA 5 mM spermidine 60 mM KCl 0.275 mg/ml BSA 15% (v/v) glycerol. Int 50~100 nM […]

SignaGen’s In Vitro siRNA Transfection Reagents

siRNA Transfection Reagent Selection Chart. Reagents Features Transfection Type Toxicity PepMute™ – Exceptional good for siRNA transfection – OK for DNA/siRNA co-transfection siRNA (Yes) DNA/siRNA (No) ++ GenMute™ – Exceptional […]

>300 Pre-made Ready to Use Adenoviruses from SignaGen

SiganGen is offering >300 pre-made and ready to use adenovirus vectors.  All the pre-packaged adenoviruses were packaged from Ad.MAX™ system with a serotype 5 adenoviral backbone* (E1/E3 deletion).  All the […]

SignaGen’s rAAV Production Service

Multi Approaches to Produce Super Infectious rAAV Particles at Super High Titer: Not like adenovirus, it is relatively harder to achieve high yield of rAAV with regular rAAV production procedures. […]

SignaGen’s In Vitro DNA Transfection Reagents

Transfection Reagent Selection Chart. Reagents Features Transfection Type Toxicity* CalFectin™ – Traditional recipe with new formulation – Most affordable and efficient – Best for large scale virus, antibody and protein […]

One-step qRT-PCR for Lentivirus Titration

1. Extract RNA using a commercial kit 2. DNase treatment using RNase free DNase 1U/ul from Promega to digest residual plasmid DNA 3. Use ABI TaqMan One-Step RT-PCR master mix […]

qRT-PCR for Lentivirus Titration

1. Make two primer probe sets U5-Psi: U5-Psi forward: TGTGTGCCCGTCTGTTGTGT U5-Psi reverse: GAGTCCTGCGTCGAGAGAGC U5-Psi probe: FAM-CAGTGGCGCCCGAACAGGGA-TAMARA WPRE: WPRE forward: CCGTTGTCAGGCAACGTG WPRE reverse: AGCTGACAGGTGGTGGCAAT WPRE probe: FAMTGCTGACGCAACCCCCACTGGT-TAMARA 2. Purify RNA from […]