CCAGAAATGGCGCCGGAGGCGGGAACAAGGTGGTGGATGAGTGCTACATCCCCAATTACTTGCTCCCCAAAACCCAGCCTGAGC
TCCAGTGGGCGTGGACTAATATGGAACAGTATTTAAG
Recent Posts
- Validated Target Region against Human HSD17B13 Gene
- Validated Target Region for TLR4 Gene
- Mouse EGR1 Validated Target Region
- Human ChAT Promoter
- Validated Target Region against Mouse G3BP Gene
- Two Validated Mouse SV2C Target Regions
- Validated Target Region against Mouse Cacna1c Gene
- Luna Universal Probe One-Step RT-qPCR for Detection of Covid-19
- RT-qPCR Reaction Conditions for Detection of Covid-19 by FDA and CDC
- AAV8-GFAP0.7-emGFP-miRNA(mPTBP1) Ready to Package
- Validated Target Region against Mouse PTBP1 Gene
- Research Use Only 2019-Novel Coronavirus (2019-nCoV, Covid-19) Real-time RT-PCR Primers and Probes
- Bmi-1 Validated target Regions
- Validated siRNA Targeting Mouse Trpv1 Gene
- A Novel AAV Serotype B1 for CNS Transduction
- Novel AAV-F AAV-S for Neuronal Cortex Transduction
- Virus used in gene therapies may pose cancer risk, dog study hints
- Why do I see amplification curves in my NTC samples?
- Why is my no template control (NTC) real-time Ct value < 35 cycles in my qPCR Assay?
- qPCR: Avoiding Signals in the No-template Control (NTC)
- Human HEY1 siRNA Validated
- EGFP Primers and Probe for qPCR
- AAV Anc80L65 VP1
- Sequence of AAV6 Assembly-Activating Protein (AAP)
- Sequence of AAV4 Assembly-Activating Protein (AAP)
- Sequence of AAV3B Assembly-Activating Protein (AAP)
- Sequence of AAV1 Assembly-Activating Protein (AAP)
- Sequence of AAV9 Assembly-Activating Protein (AAP)
- Sequence of AAV8 Assembly-Activating Protein (AAP)
- Sequence of AAV5 Assembly-Activating Protein (AAP)
- Sequence of AAV2 Assembly-Activating Protein (AAP)
- Validated Target Region against Mouse Lamtor1
- Two Validated Target Regions against Mouse ROCK2
- Two validated target regions
- Validated Target Region against Mouse Rock2
- Human VMD2 Promoter