Skip to content

All posts by signagen

p19 Promoter

CCAGAAATGGCGCCGGAGGCGGGAACAAGGTGGTGGATGAGTGCTACATCCCCAATTACTTGCTCCCCAAAACCCAGCCTGAGC TCCAGTGGGCGTGGACTAATATGGAACAGTATTTAAG

p40 Promoter

GGGTCACCAAGCAGGAAGTCAAAGACTTTTTCCGGTGGGCAAAGGATCACGTGGTTGAGGTGGAGCATGAGTTCTACGTCAAAAAGGGTGGAGCCAAGAAAAG ACCCGCCCCCAGTGACGCAGATATAAGTGAGCCCAAACGGGTGCGCGAGTCAGTTGCGCAGCCATCGACGTCAGACGCT

TATAless p5 Promoter

GGAGGGGTGGAGTCGTGACGTGAATTACGTCATAGGGTTAGGGAGGTCCTGTATTAGAGGTCACGTGAGTGTTTTGCGACATTTTGCGACACCA TGTGGTCTCGCTGGGGGGGGGGGCCCGAGTGAGCACGCAGGGTCTCCATTTTGAAGCGGGAGGTTTGAACT

Commonly Used Primers

3’AOX1 GCAAATGGCATTCTGACATCC For Pichia vectors with AOX1 terminator, reverse primer 5’AOX1 GACTGGTTCCAATTGACAAGC For Pichia vectors with AOX1 promoter, forward primer 35S promoter CTATCCTTCGCAAGACCCTTC CaMV 35S promoter, forward primer AC5 ACACAAAGCCGCTCCATCAG […]

Sim1 Specific Promoter for PVN Neurons

1 GGTACCGAGG CGCGCAGCCG TGGGGAAATC CTGGCCACTG TCTGGGATGC 51 TATTCGCACG CGTTCCTGGA GCCTCGGCTA GCCAGCCCCC GCAAGGCCGC 101 ACGCTGTGCG CAGACACCCG AGTCTAGGGA GCGCGAGTGT CACTCGGCAC 151 GCCGAAGACC TCGGGGTTTG GAGCGGCGGC GGCAGCGGGG CAGCGGCGAC 201 CCCGCGCCCG GGGCTCATTA GGAGCGGAGC TGCCAGGCTC ACTGTAGGAC […]