Adeno-associated Virus (AAV)
The relationship of Bleomycins Phleomycin D1 and Zeocin
1. The Family: Bleomycins Bleomycin is the name of a broad family of glycopeptide antibiotics produced by the bacterium Streptomyces verticillus. In a clinical context, “Bleomycin” usually refers to a […]
Choice of different antibiotics for establishing stable cell line
Choice of different antibiotics for establishing a stable cell line1. Zeocin (BleoR) – The “Gold Standard” for QualityResearch indicates that Zeocin is often the best choice for human cells like […]
rtTA(1st Gen), rtTA -advanced (2nd Gen)and Tet-On(3Gen)
1. rtTA (Original 1st Generation)• Structure: This was the original fusion of a reverse Tet repressor (rTetR) and the full-length VP16 activation domain from Herpes Simplex Virus.• Mutations: Contains 4 […]
P7 Promoter of AAV Serotype 5
agcagtgatgtcataatgatgtaatgcttattgtcacgcgatagttaatgattaacagtcatgtgatgtgttttatccaataggaagaaagcgcgcgtatgagttctcgcgagacttccggggtataaaagaccgagtgaacgagcccgccgccattctttgctctggactgctagaggaccctcgctgcc
AAV5 P41 vs AAV2 P40 Promoters
The P41 and 40 promoters are the capsid gene promoters of different Adeno-Associated Virus (AAV) serotypes, driving the expression of the structural viral proteins (VP1, VP2, VP3). They exhibit key […]
Cis-Acting Elements and Trans-Acting Factors on AAV2 Promoters
The three promoters are functionally interconnected through their shared regulatory elements, leading to the coordinated but hierarchical expression of AAV’s replication (Rep) and capsid (Cap) genes. Promoter Cis-Acting Elements (Key […]
Strength of AAV P5, P19 and P40 Promoters in Serotype 2
The AAV serotype 2 promoters P5, P19, and P40 exhibit a distinct hierarchy of strength during a productive lytic infection (i.e., in the presence of a helper virus like adenovirus, […]