Clean everything You must have a clean working area to titer your AAV by ddPCR. Droplet digital PCR is a sensitive assay, so cross contamination into a no template control […]
All posts by signagen - 4. page
Adenovirus Type C qPCR Titration Primers and Probe
Target Penton:FORWARD: TCGACACCACCCGTGTGTACREVERSE: TGCTGTGGTCGTTCTGGTAGTTPROBE: TGGACAACAAGTCAACGGATGTGGCA
Density and Refractive Index for CsCl
Density (g/cm^3) Refractive index 1.0047 1.3333 1.0125 1.334 1.0204 1.3348 1.0284 1.3356 1.0365 1.3364 1.0447 1.3372 1.0531 1.338 1.0615 1.3388 1.07 1.3397 1.0788 1.3405 1.0877 1.3414 1.0967 1.3423 1.1059 1.3432 […]
Cell Culture Antibiotic Selection Guide
Product Name Gram (+)bacteria Gram (-)bacteria Yeasts Molds Mycoplasma Suggested Working Conc. Amphotericin B † † 2.5 mg/L Amphotericin B-Solubilized (Approx. 45%) † † […]
DOS & DON’TS OF PLASMID PURIFICATION
Plasmid purification is a common technique in most molecular biology labs. While the standard alkaline lysis method had been well established, a surprising number of things still can go wrong. […]
Membrane Information
Polytetrafluoroethylene (PTFE)Hydrophobic membrane. Resistant to organic solvents as well as strong acids and bases. Low protein binding. Low in extractables. Main applications are the filtration of non-aqueous samples. Prior to […]
Quantification of AAV particles and empty capsids by optical density measurement
Predicted relationship of capsid to vector genome ratio (cp/vg) and absorbance ratio (A260/A280) for a denatured rAAV*. The theoretical A260/A280 ratio was plotted for the rAAV vector with a cp/vg […]