Adenovirus Type C qPCR Titration Primers and Probe Target Penton:FORWARD: TCGACACCACCCGTGTGTACREVERSE: TGCTGTGGTCGTTCTGGTAGTTPROBE: TGGACAACAAGTCAACGGATGTGGCA
Recent Posts AAV Rep Protein Functions pUCmini-iCAP AAV Capsid Plasmid MAAP Sequence of AAV2 What is MAAP in AAV? AAV5 P41 Promoter How many AAV particles can be made in one HEK293T cell? Splice Donor and Acceptor Sites AAV(PHP.eB)-mGAD65-GFP and AAV(PHP.eB)-mDLX-GFP Ready to Package to Transduce GABAergic Interneurons. AAV Rh32.33 VP1 Gene AAVhu68-CMV-GFP and AAVhu68-CAG-fLuc Ready to Package Deletion of the B-B’ or C-C’ in AAV ITR has a minimal impact on AAV production but increases transgene expression How Does pH Affect DNA Stability? AAV(2-Retro)-Syn-axon-GCaMP6s Ready to Pacakge What is pH Value of ddH2O? Liver-detargeted AAV(9.61)-CMV-GFP Ready to Package for Specific Heart and Smooth Muscle Transductoin Liver-detargeted AAV(9.45)-CMV-GFP Ready to Package for Specific Heart and Smooth Muscle Transductoin AAV(BI-hTFR1)-CMV-GFP Ready to Package for Brain-wide Gene Delivery How many adenovirus particles can be made in one HEK293 cell? AAV(BI30)-CBh-Cre-ERT2 Ready to Package for Tamoxifen-induced Cre Expression in Endothelial Cell of CNS AAV(Myo4A)-CMV-GFP is Ready to Package How to Amplify An Adenovirus Write for us sponsored posts How to avoid contamination in qPCR effectively AAV(Rec2.V7)-CAG-EGFP Ready to Package How to Improve 2A Linker Cleavage Efficiency AAVhu.14 Capsid Protein VP1 (Cap) Gene AAVhu.32 Capsid Protein VP1 (cap) Gene AAVhu68 Capsid Protein (VP1) Gene AAVrh.74 Capsid Sequence How to avoid cross-contamination in qPCR Reduce the risk of cross-contamination from the amplicon/template and previous reactions for a qPCR Difference between dye-based vs probe-based qPCR OmpA Signal for Protein Expression Isopycnic Centrifugation High-cell-density cultivation (HCDC) Is Kozak sequence essential for transgene expression in lentivirus?
CategoriesCategories Select Category Adeno-associated Virus (AAV) Adenovirus blogs Lentivirus Miscellaneous news Transfection Transgenic Animals
Archives Archives Select Month July 2025 June 2025 May 2025 April 2025 March 2025 February 2025 January 2025 December 2024 November 2024 October 2024 August 2024 July 2024 April 2024 February 2024 January 2024 December 2023 November 2023 July 2023 June 2023 May 2023 March 2023 February 2023 December 2022 November 2022 August 2022 January 2022 December 2021 November 2021 September 2021 July 2021 April 2021 March 2021 February 2021 January 2021 December 2020 November 2020 October 2020 September 2020 August 2020 July 2020 June 2020 May 2020 April 2020 February 2020 January 2020 November 2019 October 2019 September 2019 August 2019 July 2019 June 2019 May 2019 February 2019 December 2018 November 2018 October 2018 September 2018 July 2018 June 2018 May 2018 April 2018 March 2018 February 2018 January 2018 November 2017 October 2017 August 2017 May 2017 March 2017 January 2017 October 2016 September 2016 August 2016 July 2016 June 2016 May 2016 April 2016 March 2016 February 2016 January 2016 December 2015 November 2015 October 2015