Highly efficient homology-driven genome editing in human T cells by combining zinc-finger nuclease mRNA and AAV6 donor delivery The adoptive transfer of engineered T cells for the treatment of cancer, autoimmunity, and infectious disease […]
All posts by signagen - 22. page
pTRE-miniCMV or CMVtight
316 bp: gagtttactccctatcagtgatagagaacgtatgtcgagtttactccctatcagtgatagagaacgatgtcgagtttactccctatcagtgatagagaacgtatgtcgagtttactccctat cagtgatagagaacgtatgtcgagtttactccctatcagtgatagagaacgtatgtcgagtttatccctatcagtgatagagaacgtatgtcgagtttactccctatcagtgatagagaa cgtatgtcgaggtaggcgtgtacggtgggaggcctatataagcagagctcgtttagtgaaccgtcagatcgcc
LV-HB9-mCherry Ready to Package
LV-HB9-mCherry Ready to Package
AAV9-GFAP-GFP Ready to Package
AAV9-GFAP-GFP Ready to Package
An Ancestral rAAV Serotype Anc80L65
The researchers synthesized one of the ancestral AAVs, Anc80L65, and showed that it could infect mouse liver, muscle and retina, without eliciting a major immune response. In addition, Anc80L65 was […]
Human GPR55 siRNA
Human GPR55 siRNAs: 5′-GAAUUCCGCAUGAACAUCAUU-3′ 5′-GAGAAACAGCUUUAUCGUAUU-3′ 5′-AAGAACAGGUGGCCCGAUUUU-3′ 5′-GCUACUACUUUGUCAUCAAUU-3′
AAV8-ApoE/AAT1-Luc Ready to Package
AAV8-ApoE/AAT1-Luc Ready to Package
LV-HB9-GFP Ready to Package
LV-HB9-GFP Ready to Package
A Novel AAV Capsid AAV-AS Was Recently Identified
A novel vector AAV-AS, generated by the insertion of a poly-alanine peptide, is capable of extensive gene transfer throughout the CNS after systemic administration in adult mice. AAV-AS is 6- […]
AAV-CaMKIIa-hM4D(Gi)-mCherry Ready to Package
AAV-CaMKIIa-hM4D(Gi)-mCherry Ready to Package