Adenovirus Type C qPCR Titration Primers and Probe Target Penton:FORWARD: TCGACACCACCCGTGTGTACREVERSE: TGCTGTGGTCGTTCTGGTAGTTPROBE: TGGACAACAAGTCAACGGATGTGGCA
Recent Posts AAV(MG1.1)-CMV-GFP and AAV(MG1.2)-CMV-GFP Ready to Package for Microglia Transduction Gibson Assembly Cloning Tips for Maximizing Ligation Efficiencies Troubles with ligation? Electroporation Tips Electroporation vs. Heat Shock Transformation Causes and Solutions for Bad qPCR Efficiency Lentivirus Formulation Buffer A195 Buffer for Adenovirus Formulation and Long Term Storage DNA/RNA non-specific endonuclease [Serratia marcescens] DNA/RNA non-specific endonuclease [Serratia marcescens] DNA/RNA non-specific endonuclease [Serratia marcescens] Starting Materials to Run a ddPCR for rAAV Titration with An AutoDG Droplet Generator and QX 200 Droplet Reader Tips and tricks for performing ddPCR LV-EF1a-GFP-Puro in Baboon Envelope Pseudotype, Ready to Package Adenovirus Type C qPCR Titration Primers and Probe Density and Refractive Index for CsCl Cell Culture Antibiotic Selection Guide AAV5-RPhpe427-GFP and AAV5-RPhpe1289-GFP Ready to Package DOS & DON’TS OF PLASMID PURIFICATION AAV9-hSyn-hM3D(Gq)-mCherry and AAV9-hSyn-hM4D(Gi)-mCherry Ready to Package Membrane Information Quantification of AAV particles and empty capsids by optical density measurement qPCR Determination of Mycoplasma in AAV Samples AAV10 VP1 Sequence Validated Target Region against Human HSD17B13 Gene Validated Target Region for TLR4 Gene Mouse EGR1 Validated Target Region Human ChAT Promoter Validated Target Region against Mouse G3BP Gene Two Validated Mouse SV2C Target Regions Validated Target Region against Mouse Cacna1c Gene Luna Universal Probe One-Step RT-qPCR for Detection of Covid-19 RT-qPCR Reaction Conditions for Detection of Covid-19 by FDA and CDC AAV8-GFAP0.7-emGFP-miRNA(mPTBP1) Ready to Package Validated Target Region against Mouse PTBP1 Gene
CategoriesCategories Select Category Adeno-associated Virus (AAV) Adenovirus Lentivirus Miscellaneous Transfection Transgenic Animals
Archives Archives Select Month February 2023 December 2022 November 2022 August 2022 January 2022 December 2021 November 2021 September 2021 July 2021 April 2021 March 2021 February 2021 January 2021 December 2020 November 2020 October 2020 September 2020 August 2020 July 2020 June 2020 May 2020 April 2020 February 2020 January 2020 November 2019 October 2019 September 2019 August 2019 July 2019 June 2019 May 2019 February 2019 December 2018 November 2018 October 2018 September 2018 July 2018 June 2018 May 2018 April 2018 March 2018 February 2018 January 2018 November 2017 October 2017 August 2017 May 2017 March 2017 January 2017 October 2016 September 2016 August 2016 July 2016 June 2016 May 2016 April 2016 March 2016 February 2016 January 2016 December 2015 November 2015 October 2015