CCTCAGAGAGATCAGAGAGTT
Recent Posts
- DNA/RNA non-specific endonuclease [Serratia marcescens]
- DNA/RNA non-specific endonuclease [Serratia marcescens]
- DNA/RNA non-specific endonuclease [Serratia marcescens]
- Starting Materials to Run a ddPCR for rAAV Titration with An AutoDG Droplet Generator and QX 200 Droplet Reader
- Tips and tricks for performing ddPCR
- LV-EF1a-GFP-Puro in Baboon Envelope Pseudotype, Ready to Package
- Adenovirus Type C qPCR Titration Primers and Probe
- Density and Refractive Index for CsCl
- Cell Culture Antibiotic Selection Guide
- AAV5-RPhpe427-GFP and AAV5-RPhpe1289-GFP Ready to Package
- DOS & DON’TS OF PLASMID PURIFICATION
- AAV9-hSyn-hM3D(Gq)-mCherry and AAV9-hSyn-hM4D(Gi)-mCherry Ready to Package
- Membrane Information
- Quantification of AAV particles and empty capsids by optical density measurement
- qPCR Determination of Mycoplasma in AAV Samples
- AAV10 VP1 Sequence
- Validated Target Region against Human HSD17B13 Gene
- Validated Target Region for TLR4 Gene
- Mouse EGR1 Validated Target Region
- Human ChAT Promoter
- Validated Target Region against Mouse G3BP Gene
- Two Validated Mouse SV2C Target Regions
- Validated Target Region against Mouse Cacna1c Gene
- Luna Universal Probe One-Step RT-qPCR for Detection of Covid-19
- RT-qPCR Reaction Conditions for Detection of Covid-19 by FDA and CDC
- AAV8-GFAP0.7-emGFP-miRNA(mPTBP1) Ready to Package
- Validated Target Region against Mouse PTBP1 Gene
- Research Use Only 2019-Novel Coronavirus (2019-nCoV, Covid-19) Real-time RT-PCR Primers and Probes
- Bmi-1 Validated target Regions
- Validated siRNA Targeting Mouse Trpv1 Gene
- A Novel AAV Serotype B1 for CNS Transduction
- Novel AAV-F AAV-S for Neuronal Cortex Transduction
- Virus used in gene therapies may pose cancer risk, dog study hints
- Why do I see amplification curves in my NTC samples?
- Why is my no template control (NTC) real-time Ct value < 35 cycles in my qPCR Assay?
- qPCR: Avoiding Signals in the No-template Control (NTC)