Skip to content

Miscellaneous

DNA/RNA non-specific endonuclease [Serratia marcescens]

atgcgctttaacaacaagatgttggccctggccgccctgctgttcgccgcacaggcgtcggccgacacgttcgaatccatcgacaactgcgcggtcggctgcccgaccggcggcagcagcaacgtgtcgatcgtgcgtcatgcttatacgttgaacaacaacagcacaaccaagttcgccaactgggtggcctatcacatcaccaaagacacgccggccagcggcaagacgcgcaactggaaaaccgacccggcgctcaatccggccgacaccctggcgcccgccgattacaccggcgccaacgcggcgctgaaggtcgatcgcggtcatcaggcgccgctggcctcgctggcgggcgtttccgactgggaatcgctgaactacctgtccaacatcacgccgcaaaagtccgatcttaaccagggcgcctgggcgcggctggaagatcaggaacgcaagctgatcgatcgcgccgacatctcctcggtctataccgtgaccgggccgttgtatgagcgtgatatgggcaaactgccgggcacccagaaagcgcacaccatccccagcgcctactggaaggtgattttcatcaacaacagcccggcggtaaaccactatgccgctttcctgttcgatcagaacacgccgaagggcgccgatttctgccaattccgcgtgacggtggacgagatcgagaaacgtaccggcctgatcatctgggccggtctgccggacgacgtacaggcttcgctgaagagcaagcccggcgtcctgccggagctgatgggctgcaaaaactga

DNA/RNA non-specific endonuclease [Serratia marcescens]

ATGCGCTTCTCCAACAAAATGCTTGCGTTGGCAGCACTGCTGTTTGCAGCGCAAGCGAGTGCAGATACCCTGGAGTCGATTGACAATTGTGCTGTGGGTTGTCCGACAGGAGGCAGCAGTAACGTGAGCATCGTACGTCATGCGTATACCCTGAACAACAATAGCACCACCAAATTTGCGAATTGGGTGGCGTACCATATTACGAAGGACACGCCGGCCTCTGGGAAAACCCGGAATTGGAAAACCGATCCCGCGCTGAATCCGGCCGATACTCTGGCACCAGCCGACTATACAGGCGCGAATGCTGCTCTGAAAGTGGATCGTGGGCATCAAGCCCCTTTAGCGTCACTTGCCGGCGTTTCTGACTGGGAATCGCTCAACTATCTCAGCAACATTACGCCGCAGAAATCTGACCTTAACCAGGGTGCATGGGCACGCTTGGAAGATCAGGAACGCAAGCTGATTGATCGTGCGGACATTTCATCCGTCTACACCGTTACTGGTCCGCTGTATGAACGCGATATGGGCAAATTACCGGGCACGCAGAAAGCGCACACGATTCCCAGTGCTTACTGGAAAGTGATCTTCATCAACAATTCGCCTGCGGTCAACCACTATGCTGCGTTCCTGTTCGATCAGAACACGCCAAAAGGTGCCGACTTTTGCCAGTTTCGCGTAACCGTAGATGAAATCGAGAAACGTACCGGCCTGATCATCTGGGCCGGTTTACCGGATGATGTGCAGGCATCCTTGAAAAGCAAACCGGGCGTTCTGCCAGAACTGATGGGTTGCAAGAATTAA

DNA/RNA non-specific endonuclease [Serratia marcescens]

1 MRFNNKMLAL AALLFAAQAS ADTLESIDNC AVGCPTGGSS NVSIVRHAYT LNNNSTTKFA 61 NWVAYHITKD TPASGKTRNW KTDPALNPAD TLAPADYTGA NAALKVDRGH QAPLASLAGV 121 SDWESLNYLS NITPQKSDLN QGAWARLEDQ ERKLIDRADI SSVYTVTGPL YERDMGKLPG 181 TQKAHTIPSA YWKVIFINNS PAVNHYAAFL FDQNTPKGAD FCQFRVTVDE IEKRTGLIIW 241 AGLPDDIQAS […]

Density and Refractive Index for CsCl

Density (g/cm^3)  Refractive index 1.0047 1.3333 1.0125 1.334 1.0204 1.3348 1.0284 1.3356 1.0365 1.3364 1.0447 1.3372 1.0531 1.338 1.0615 1.3388 1.07 1.3397 1.0788 1.3405 1.0877 1.3414 1.0967 1.3423 1.1059 1.3432 […]

Cell Culture Antibiotic Selection Guide

Product Name Gram (+)bacteria Gram (-)bacteria Yeasts Molds Mycoplasma Suggested Working Conc. Amphotericin B     † †   2.5 mg/L Amphotericin B-Solubilized (Approx. 45%)     † †   […]

DOS & DON’TS OF PLASMID PURIFICATION

Plasmid purification is a common technique in most molecular biology labs. While the standard alkaline lysis method had been well established, a surprising number of things still can go wrong. […]