CGTATGCCTATAGTGCACTTT
Recent Posts
- Validated siRNA Targeting Mouse Trpv1 Gene
- A Novel AAV Serotype B1 for CNS Transduction
- Novel AAV-F AAV-S for Neuronal Cortex Transduction
- Virus used in gene therapies may pose cancer risk, dog study hints
- Why do I see amplification curves in my NTC samples?
- Why is my no template control (NTC) real-time Ct value < 35 cycles in my qPCR Assay?
- qPCR: Avoiding Signals in the No-template Control (NTC)
- Human HEY1 siRNA Validated
- EGFP Primers and Probe for qPCR
- AAV Anc80L65 VP1
- Sequence of AAV6 Assembly-Activating Protein
- Sequence of AAV4 Assembly-Activating Protein
- Sequence of AAV3B Assembly-Activating Protein
- Sequence of AAV1 Assembly-Activating Protein
- Sequence of AAV9 Assembly-Activating Protein
- Sequence of AAV8 Assembly-Activating Protein
- Sequence of AAV5 Assembly-Activating Protein
- Sequence of AAV2 Assembly-Activating Protein
- Validated Target Region against Mouse Lamtor1
- Two Validated Target Regions against Mouse ROCK2
- Two validated target regions
- Validated Target Region against Mouse Rock2
- Human VMD2 Promoter
- AAV7m8-CMV-GFP and AAV7m8-CAG-GFP Ready to Package
- AAV5-RK-hrGFP Ready to package
- p19 Promoter
- p40 Promoter
- TATAless p5 Promoter
- Validated Target Region against Mouse TIMP1 Gene
- AAV(DJ/8)-GFAP-TetR-U6TO-miRNA Ready to Package
- Determining the concentration of protein in SDS-PAGE gel bands using ImageJ
- AAV(PHP.eB)-hSyn-SF-iGluSnFR(A184S) Ready to Package
- qPCR Primer and Probe Sequences for rAAV Titration
- Commonly Used Primers
- Sim1 Specific Promoter for PVN Neurons
- Wt AAV P5 Promoter for Rep