cagccgaatctcgcaatgaat
Recent Posts
- What Is ROX And Why Use It In qPCR?
- Top 10 Tips for Consistent qPCR
- How Well can WPRE Enhance Transgene Expression?
- AAV3 VP1
- AAV-GFAP-GFP-shRNAmir(ADK) Targeting ADK Ready to Package
- A Validated Target Region Against Mouse Tyrosine Hydroxylase (Th)
- A Validated Target Region Against Mouse TAZ
- AAV-Syn-GCaMP6f Ready to Package
- Sequences required for coordinate induction of adeno-associated virus p19 and p40 promoters by Rep protein.
- AAV1-CMV-TurboGFP Ready to Package
- AAV9-CAG-GFP-T2A-FLPo Ready to Package
- AAV3 VP1
- AAV9 VP1 Sequence
- AAV5 VP1 Sequence
- AAV1 VP1 Sequence
- AAV6 VP1 Sequence
- AAV 3B, VP1
- AAV 3B, complete genome
- Validated Target Region Targeting LacZ
- Validated Mouse LPCAT3 Target Region
- AAV7 VP1
- AAV5-GFAP-TetR-U6TO-shRNA Ready to Package
- AAV8 VP1
- Validated mJUNB Target Region Sequence
- Validated siRNA against RBJP and Hes1
- CRISPR/Cas9-based generation of knockdown mice by intronic insertion of artificial microRNA using longer single-stranded DNA
- Validated SARM1 shRNA
- Easi-CRISPR for creating knock-in and conditional knockout mouse models using long ssDNA donors
- One-Step Generation of Mice Carrying Mutations in Multiple Genes by CRISPR/Cas-Mediated Genome Engineering
- One-step generation of complete gene knockout mice and monkeys by CRISPR/Cas9-mediated gene editing with multiple sgRNAs
- CRISPR-EZ Video Protocol
- Multiple sgRNAs with overlapping sequences enhance CRISPR/Cas9-mediated knock-in efficiency
- Tild-CRISPR Allows for Efficient and Precise Gene Knockin in Mouse and Human Cells
- CRISPR Genome Editing in Mice from He Lab at UC Berkeley
- Validated GPAM Target Region Sequence
- Validated Tbk1 Target Region Sequence