Skip to content

Miscellaneous - 6. page

SM22α Promoter / Enhancer

aaggggaacgtgaggaaggcgtttggatagtgcctggttgcggccaggctgcagtcaagactagttcccaccaactcgattttaaagccttgcaagaaggtggcttgtttgtcccttgcaggttccttt gctcgggccaaactctagaatgcctccccctttctttctcattgaagagcagacccaagtccgggtaacaaggaagggtttcagggtcctgcccataaaaggtttttcccggccgccctcagcaccgcccc gccccgacccccgcagcatctccaaagcatgcagagaatgtctccggctgcccccgacagactgctccaacttggtgtctttccccaaatatggagcctgtgtggagtgagtggggcggcccggggtg gtgagccaagcagacttccatgggcagggaggggcgccacggggcggcagaggggtgacatcactgcctaggcggcctttaaacccctcacccagccggcgccccggcccgtctgccccagccca gacaccgaagctactctccttccagtccacaaacgaccaagccttgtaagtgcaagtcatgggagcagaagggctgtgggctcaatt

Poor Efficiency of PCR

The efficiency of any PCR can be evaluated by performing a dilution series experiment using the target assay. We recommend a 10-fold dilution series. After properly setting the baseline and […]

What Is ROX And Why Use It In qPCR?

To ROX or not to ROX? That is the question. I frequently see people confused about what ROX is and why it is used in qPCR. For very sensitive PCR […]

Top 10 Tips for Consistent qPCR

qPCR requires a certain amount of technical finesse to ensure consistent data across experiments. The main challenges encountered when starting out with this technique are contamination issues or inconsistency between […]