Validated Target Region Sequence against Mouse Component 3 (C3) # 1. CCATCAAGATTCCAGCCAGTA # 2. CCAGAGTTTATTCCTTCATTT # 3. ACGGGACAGCCTTCGTGATTT
Recent Posts AAV(Myo4A)-CMV-GFP is Ready to Package How to Amplify An Adenovirus Write for us sponsored posts How to avoid contamination in qPCR effectively AAV(Rec2.V7)-CAG-EGFP Ready to Package How to Improve 2A Linker Cleavage Efficiency AAVhu.14 Capsid Protein VP1 (Cap) Gene AAVhu.32 Capsid Protein VP1 (cap) Gene AAVhu68 Capsid Protein (VP1) Gene AAVrh.74 Capsid Sequence How to avoid cross-contamination in qPCR Reduce the risk of cross-contamination from the amplicon/template and previous reactions for a qPCR Difference between dye-based vs probe-based qPCR OmpA Signal for Protein Expression Isopycnic Centrifugation High-cell-density cultivation (HCDC) Is Kozak sequence essential for transgene expression in lentivirus? How to remove protein from PEG precipitated lentivirus Primers and probes used for rAAV quantitative analysis Quantification for residual host cell DNA contamination in the rAAV prep via qPCR or ddPCR analysis targeting highly repetitive genome sequences How to protect RNA from degradation? What is the main reason for RNA being unstable? Why Are Transgenes Cloned into Lentiviral Vectors Without a Poly(A) Signal? AAV(Myo1A)-CMV-GFP Ready to Package Potential Reasons for Lack of Supercoiled DNA Transfection Efficiency: What Makes Plasmid DNA Transfection Grade Why Uncut Plasmid DNA on Agarose Gel Has 3 Bands AAV6.2-CMV-GFP and AAV6.2-CMV-iCre Ready to Package LV-Syn-GFP-shRNAmir-WPRE Ready to Package to Knock Down Gene Expression in Neurons AAV(cc47)-CMV-GFP is Ready to Package AAV(MYO)-CMV-GFP is Ready to Package AAV(REC2)-CMV-GFP is Ready to Package AAV Rh20 VP1 Gene AAV Rec2 Capsid Sequence Homemade qPCR Mix Recipe Home made qPCR Master Mix
CategoriesCategories Select Category Adeno-associated Virus (AAV) Adenovirus blogs Lentivirus Miscellaneous news Transfection Transgenic Animals
Archives Archives Select Month March 2025 February 2025 January 2025 December 2024 November 2024 October 2024 August 2024 July 2024 April 2024 February 2024 January 2024 December 2023 November 2023 July 2023 June 2023 May 2023 March 2023 February 2023 December 2022 November 2022 August 2022 January 2022 December 2021 November 2021 September 2021 July 2021 April 2021 March 2021 February 2021 January 2021 December 2020 November 2020 October 2020 September 2020 August 2020 July 2020 June 2020 May 2020 April 2020 February 2020 January 2020 November 2019 October 2019 September 2019 August 2019 July 2019 June 2019 May 2019 February 2019 December 2018 November 2018 October 2018 September 2018 July 2018 June 2018 May 2018 April 2018 March 2018 February 2018 January 2018 November 2017 October 2017 August 2017 May 2017 March 2017 January 2017 October 2016 September 2016 August 2016 July 2016 June 2016 May 2016 April 2016 March 2016 February 2016 January 2016 December 2015 November 2015 October 2015