Analysis of transduction properties of AAV2/8BP2 virus A, B Representative 20× confocal images of immunostained vibratome sections from retinas of mice subretinally injected (A) or intravitreally injected (B) with viruses. […]
Adeno-associated Virus (AAV) - 15. page
ssAAV vs. scAAV
For ssAAV vectors, the coding sequence and complementary sequence of the transgene expression cassette are on separate strands and are packaged in separate viral capsids. For scAAV vectors, both the […]
rAAV in Serotype shh10 Transduces Rat Retina Müller Cells
rShH10 expression following intravitreal injection in the adult rat retina. Confocal imaging of immunostained transverse retinal sections 3 weeks post-injection of 2.5×1010 viral particles (vector genomes) of dsCAG-GFP vectors with […]
DNA Shuffling of Adeno-associated Virus Yields Functionally Diverse Viral Progeny
Adeno-associated virus (AAV) vectors are extremely effective gene-delivery vehicles for a broad range of applications. However, the therapeutic efficacy of these and other vectors is currently limited by barriers to […]
Optogenetic interrogation of neural circuits: technology for probing mammalian brain structures
Table 1. Comparison table of optogenetic tools suitable for fast in vivo use in mammals and other animals. Next table | Figures & tables Opsin Host organism Wavelength sensitivity Mode […]
Sequence of 2xITR in scAAV cis Vector
LTR left: GGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTGGAGGGGTGGAGTCGTGA LTR right: CCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGA
Sequence of 2xITR in rAAV cis Vector
ITR Left (1-142): CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTG ITR Right (1-142): GGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGGG
Managing MicroRNAs with Vector-Encoded Decoy-Type Inhibitors
A rapidly growing understanding of the complex circuitry of microRNA (miRNA)-mediated gene regulation is attracting attention to miRNAs as new drug targets. Targeted miRNA suppression is achieved in a sequence-specific […]
AAV9 VRs and their reported functional roles
AAV9 VRs and their reported functional roles. Refer to http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3393551 VR AAV9 aa Reported functional role(s) References VR-I 262–269 Unknown in AAV9 VR-II 327–332 DE loop at the 5-fold channel; […]
Nucleotide and amino acid identities between rodent and other AAV capsids
AAV-mo.1 AAV-ra.1 AAV-1 AAV-2 AAV-hu.2 AAV-3a AAV-4 AAV-5 AAV-7 AAV-8 AAV-9 Avian Snake % Amino acid identity AAV-mo.1 100 58 56 56 56 55 51 53 56 56 56 […]