AAV-PHP.B is a capsid variant derived from AAV serotype 9 that additionally contains the heptapeptide TLAVPFK. This AAV variant can cross the blood-brain barrier after intravenous injection and was selected […]
Adeno-associated Virus (AAV) - 13. page
Novel AAV Serotypes to Penetrate Blood-brain Barrier for Full Transgene Expression in CNS
Recombinant adeno-associated viruses (rAAVs) are commonly used vehicles for in vivo gene transfer. However, the tropism repertoire of naturally occurring AAVs is limited, prompting a search for novel AAV capsids […]
Two shRNAs Targeting Mouse PDXP
Two shRNAs Targeting Mouse PDXP CCGGCAAGCCCAGCCCTTACATGTTCTCGAGAACATGTAAGGGCTGGGCTTGTTTTTG CCGGCTGGAGACCGACATACTCTTTCTCGAGAAAGAGTATGTCGGTCTCCAGTTTTTG
AAV-TBG-saCas9-U6-sgRNA Ready to Package
AAV-TBG-saCas9-U6-sgRNA Ready to Package
AAV-tRNA-sgRNA-CMV-hAsCpf1 Ready to Package
AAV-tRNA-sgRNA-CMV-hAsCpf1 Ready to Package
AAV-EF1a-FRT-mCherry-WPRE and AAV-CAG-FRT-GFP-WPRE Ready to Package
AAV-EF1a-FRT-mCherry-WPRE and AAV-CAG-FRT-GFP-WPRE Ready to Package
AAV-CMV-SpCas9-HF1 (Cas9 High-fidelity Version) Ready to Package
AAV-CMV-SpCas9-HF1 (Cas9 High-fidelity Version) Ready to Package
Effective delivery of large genes to the retina by dual AAV vectors
Retinal gene therapy with adeno-associated viral (AAV) vectors is safe and effective in humans. However, AAV’s limited cargo capacity prevents its application to therapies of inherited retinal diseases due to […]
AAV-CMV-OptoSTIM1 Ready to Package
AAV-CMV-OptoSTIM1 Ready to Package
AAV-CMV-pHuji Ready to Package
AAV-CMV-pHuji Ready to Package