Skip to content

Adenovirus

Early E1A Gene from Human Adenovirus Serotype 5

atgagacatattatctgccacggaggtgttattaccgaagaaatggccgccagtcttttggaccagctgatcgaagaggtactggctgataatcttccacctcctagccattttgaaccacctacccttcacgaactgtatgatttagacgtgacggcccccgaagatcccaacgaggaggcggtttcgcagatttttcccgactctgtaatgttggcggtgcaggaagggattgacttactcacttttccgccggcgcccggttctccggagccgcctcacctttcccggcagcccgagcagccggagcagagagccttgggtccggtttctatgccaaaccttgtaccggaggtgatcgatcttacctgccacgaggctggctttccacccagtgacgacgaggatgaagagggtgaggagtttgtgttagattatgtggagcaccccgggcacggttgcaggtcttgtcattatcaccggaggaatacgggggacccagatattatgtgttcgctttgctatatgaggacctgtggcatgtttgtctacagtcctgtgtctgaacctgagcctgagcccgagccagaaccggagcctgcaagacctacccgccgtcctaaaatggcgcctgctatcctgagacgcccgacatcacctgtgtctagagaatgcaatagtagtacggatagctgtgactccggtccttctaacacacctcctgagatacacccggtggtcccgctgtgccccattaaaccagttgccgtgagagttggtgggcgtcgccaggctgtggaatgtatcgaggacttgcttaacgagcctgggcaacctttggacttgagctgtaaacgccccaggccataa

How to Amplify An Adenovirus

To amplify an adenovirus, you typically infect a permissive cell line, like HEK 293 cells, with the adenovirus at a suitable multiplicity of infection (MOI), allowing the virus to replicate […]

1st, 2nd Generations vs. Gutless Adenovirus Systems

Map of adenovirus serotype 5 genome and different generations of adenoviral vectors. Early transcripts are represented by E1–E4 regions and late transcripts are represented by L1–L5 regions. MLP: major late […]

What is WPRE?

Woodchuck Hepatitis Virus (WHP) Posttranscriptional Regulatory Element (WPRE) is a DNA sequence that, when transcribed creates a tertiary structure enhancing expression. Commonly used in molecular biology to increase expression of […]

Key properties of a viral vector

Viral vectors are tailored to their specific applications but generally share a few key properties: Safety: Although viral vectors are occasionally created from pathogenic viruses, they are modified in such […]