atgagacatattatctgccacggaggtgttattaccgaagaaatggccgccagtcttttggaccagctgatcgaagaggtactggctgataatcttccacctcctagccattttgaaccacctacccttcacgaactgtatgatttagacgtgacggcccccgaagatcccaacgaggaggcggtttcgcagatttttcccgactctgtaatgttggcggtgcaggaagggattgacttactcacttttccgccggcgcccggttctccggagccgcctcacctttcccggcagcccgagcagccggagcagagagccttgggtccggtttctatgccaaaccttgtaccggaggtgatcgatcttacctgccacgaggctggctttccacccagtgacgacgaggatgaagagggtgaggagtttgtgttagattatgtggagcaccccgggcacggttgcaggtcttgtcattatcaccggaggaatacgggggacccagatattatgtgttcgctttgctatatgaggacctgtggcatgtttgtctacagtcctgtgtctgaacctgagcctgagcccgagccagaaccggagcctgcaagacctacccgccgtcctaaaatggcgcctgctatcctgagacgcccgacatcacctgtgtctagagaatgcaatagtagtacggatagctgtgactccggtccttctaacacacctcctgagatacacccggtggtcccgctgtgccccattaaaccagttgccgtgagagttggtgggcgtcgccaggctgtggaatgtatcgaggacttgcttaacgagcctgggcaacctttggacttgagctgtaaacgccccaggccataa
Adenovirus
How many adenovirus particles can be made in one HEK293 cell?
HEK293 cells can produce over 100,000 adenovirus particles per cell when using optimized protocols and transfection methods. Here’s a more detailed explanation:
How to Amplify An Adenovirus
To amplify an adenovirus, you typically infect a permissive cell line, like HEK 293 cells, with the adenovirus at a suitable multiplicity of infection (MOI), allowing the virus to replicate […]
A195 Buffer for Adenovirus Formulation and Long Term Storage
10 mM Tris-HCl, 10 mM histidine, 75 mM NaCl, 5% sucrose (w/v), 1 mM MgCl2, 0.02% (w/v) PS-80 (polysorbate-80), 0.1 mM EDTA, 0.5% Ethanol (v/v), pH 7.4
Adenovirus Type C qPCR Titration Primers and Probe
Target Penton:FORWARD: TCGACACCACCCGTGTGTACREVERSE: TGCTGTGGTCGTTCTGGTAGTTPROBE: TGGACAACAAGTCAACGGATGTGGCA
1st, 2nd Generations vs. Gutless Adenovirus Systems
Map of adenovirus serotype 5 genome and different generations of adenoviral vectors. Early transcripts are represented by E1–E4 regions and late transcripts are represented by L1–L5 regions. MLP: major late […]
The WPRE reduces readthrough transcription from retroviral vectors
The woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) increases transgene expression from a variety of viral vectors, although the precise mechanism is not known. WPRE is most effective when placed […]
What is WPRE?
Woodchuck Hepatitis Virus (WHP) Posttranscriptional Regulatory Element (WPRE) is a DNA sequence that, when transcribed creates a tertiary structure enhancing expression. Commonly used in molecular biology to increase expression of […]
Key properties of a viral vector
Viral vectors are tailored to their specific applications but generally share a few key properties: Safety: Although viral vectors are occasionally created from pathogenic viruses, they are modified in such […]