Knockdown mouse models, where gene dosages can be modulated, provide valuable insights into gene function. Typically, such models are generated by embryonic stem (ES) cell-based targeted insertion, or pronuclear injection, […]
Monthly Archives: September 2018
Validated SARM1 shRNA
5’CCGGCAAGGTCTATGCGATGCTATACTCGAGTATAGCATCGCATAGACCTTGTTTTTG 3’
Easi-CRISPR for creating knock-in and conditional knockout mouse models using long ssDNA donors
CRISPR/Cas9-based genome editing can easily generate knockout mouse models by disrupting the gene sequence, but its efficiency for creating models that require either insertion of exogenous DNA (knock-in) or replacement […]
One-Step Generation of Mice Carrying Mutations in Multiple Genes by CRISPR/Cas-Mediated Genome Engineering
Mice carrying mutations in multiple genes are traditionally generated by sequential recombination in embryonic stem cells and/or time-consuming intercrossing of mice with a single mutation. The CRISPR/Cas system has been […]
One-step generation of complete gene knockout mice and monkeys by CRISPR/Cas9-mediated gene editing with multiple sgRNAs
The CRISPR/Cas9 system is an efficient gene-editing method, but the majority of gene-edited animals showed mosaicism, with editing occurring only in a portion of cells. Here we show that single […]
CRISPR-EZ Video Protocol
CRISPR-EZ Video Protocol
Multiple sgRNAs with overlapping sequences enhance CRISPR/Cas9-mediated knock-in efficiency
Abstract The CRISPR/Cas9 system is widely applied in genome engineering due to its simplicity and versatility. Although this has revolutionized genome-editing technology, knockin animal generation via homology directed repair (HDR) […]
Tild-CRISPR Allows for Efficient and Precise Gene Knockin in Mouse and Human Cells
Abstract The targeting efficiency of knockin sequences via homologous recombination (HR) is generally low. Here we describe a method we call Tild-CRISPR (targeted integration with linearized dsDNA-CRISPR), a targeting strategy […]
CRISPR Genome Editing in Mice from He Lab at UC Berkeley
CRISPR-mediated mouse genome editing is typically accomplished by microinjection of Cas9 DNA/RNA and sgRNA into zygotes to achieve editing in one step. We developed a simple and economic electroporation-based strategy, […]
Validated GPAM Target Region Sequence
Validated GPAM Target Region Sequence: GACGGAGGCTCGATGAAAC GACTGTGGGTTCAAACCTA