ITR Left (1-142): CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTG ITR Right (1-142): GGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGGG
What is THP-1 Cell?
THP1 is a human monocytic cell line derived from an acute monocytic leukemia patient. It is used to test leukemia cell lines in immunocytochemical analysis of protein-protein interaction, and immunohistochemistry. […]
Codon Usage Measurement Tools
https://www.dna20.com/resources/bioinformatics-tools
Good transgene expression measured by CAI
Codon Adaptation Index (CAI) of your gene is 0.81. A CAI of 1.0 is considered ideal while a CAI of >0.8 is rated as good for expression in the desired […]
Codon Adaptation Index
The Codon Adaptation Index (CAI) is the most widespread technique for analyzing Codon usage bias. As opposed to other measures of codon usage bias, such as the ‘effective number of […]
Codon usage bias
Codon usage bias refers to differences in the frequency of occurrence of synonymous codons in coding DNA. A codon is a series of three nucleotides (a triplet) that encodes a […]
How to optimize a synthetic gene for a specific specie
Refer to https://www.idtdna.com/CodonOpt
Managing MicroRNAs with Vector-Encoded Decoy-Type Inhibitors
A rapidly growing understanding of the complex circuitry of microRNA (miRNA)-mediated gene regulation is attracting attention to miRNAs as new drug targets. Targeted miRNA suppression is achieved in a sequence-specific […]
Going viral: chimeric antigen receptor T-cell therapy for hematological malignancies.
On July 1, 2014, the United States Food and Drug Administration granted ‘breakthrough therapy’ designation to CTL019, the anti-CD19 chimeric antigen receptor T-cell therapy developed at the University of Pennsylvania. […]