10 mM Tris-HCl, 10 mM histidine, 75 mM NaCl, 5% sucrose (w/v), 1 mM MgCl2, 0.02% (w/v) PS-80 (polysorbate-80), 0.1 mM EDTA, 0.5% Ethanol (v/v), pH 7.4
Adenovirus
Adenovirus Type C qPCR Titration Primers and Probe
Target Penton:FORWARD: TCGACACCACCCGTGTGTACREVERSE: TGCTGTGGTCGTTCTGGTAGTTPROBE: TGGACAACAAGTCAACGGATGTGGCA
1st, 2nd Generations vs. Gutless Adenovirus Systems
Map of adenovirus serotype 5 genome and different generations of adenoviral vectors. Early transcripts are represented by E1–E4 regions and late transcripts are represented by L1–L5 regions. MLP: major late […]
The WPRE reduces readthrough transcription from retroviral vectors
The woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) increases transgene expression from a variety of viral vectors, although the precise mechanism is not known. WPRE is most effective when placed […]
What is WPRE?
Woodchuck Hepatitis Virus (WHP) Posttranscriptional Regulatory Element (WPRE) is a DNA sequence that, when transcribed creates a tertiary structure enhancing expression. Commonly used in molecular biology to increase expression of […]
Key properties of a viral vector
Viral vectors are tailored to their specific applications but generally share a few key properties: Safety: Although viral vectors are occasionally created from pathogenic viruses, they are modified in such […]
SignaGen’s Ad.MAX™ Adenovirus Expression System for Maximum Adenovirus Production
Ad.MAX™ Technology for Maximum Adenovirus Production: Ad.MAX™ technology was developed by genetically modifying virus packaging cell, HEK293 cell and adenoviral shuttle vector or adenoviral genome for maximum adenovirus production. The […]
>300 Pre-made Ready to Use Adenoviruses from SignaGen
SiganGen is offering >300 pre-made and ready to use adenovirus vectors. All the pre-packaged adenoviruses were packaged from Ad.MAX™ system with a serotype 5 adenoviral backbone* (E1/E3 deletion). All the […]
Comparison of HSV, Adenovirus, AAV, Retrovirus and Lentivirus for Gene Delivery
HSV Adenovirus AAV Retrovirus Lentivirus Genomic Integration Episomal,100% Episomal,100% Episomal >90%, Integrated Integrated Cloning Capacity 150 kb for amplicon; 40 kb for replication defective HSV 8 kb for replication defective […]