Service Quote Request
Please fill out the form below with your detailed inquiry.
-
PHONE: 1-866-918-6812
SignaGen Blog
AllAdeno-associated Virus (AAV)AdenovirusLentivirusMiscellaneousRetrovirusStable Cell LinesTransfection
qRT-PCR for Lentivirus Titration
1. Make two primer probe sets U5-Psi: U5-Psi forward: TGTGTGCCCGTCTGTTGTGT U5-Psi reverse: GAGTCCTGCGTCGAGAGAGC U5-Psi…
Concentrate Lentivirus by Ultra-centrifugation
Ultracentrifuge: Beckman LE 80K Rotor: SW28 Tubes: #326823 autoclaved (polyallomer) 1. Pool all viral…
Lentivirus Purification by Ultra-centrifugation
Before Starting: Required equipments and consumbles: 1. SW-28 rotor with buckets and caps (Kept…
Formulation of Lipofectamine 2000 and Lipofectin
LIPOFECTIN is a 1:1 (w/w) mixture of N-[1-(2,3-dioleyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA) and dioleoylphosphatidylethanolamine (DOPE). LIPOFECTAMINE…
Comparison of HSV, Adenovirus, AAV, Retrovirus and Lentivirus for Gene Delivery
HSV Adenovirus AAV Retrovirus Lentivirus Genomic Integration Episomal,100% Episomal,100% Episomal >90%, Integrated Integrated Cloning…
Lentivirus Titration via qRT-PCR
The transduction unit (TU or IFU) of the lentiviral particles was estimated using the…
Important updates waiting for you!
Enter your email address below and subscribe to our newsletter