MAAP Sequence of AAV2

ctggcccaccaccaccaaagcccgcagagcggcataaggacgacagcaggggtcttgtgcttcctgggtacaagtacctcggacccttcaacggactcgacaagggagagccggtcaacgaggca
gacgccgcggccctcgagcacgacaaagcctacgaccggcagctcgacagcggagacaacccgtacctcaagtacaaccacgccgacgcggagtttcaggagcgccttaaagaagatacgtcttt
tgggggcaacctcggacgagcagtcttccaggcgaaaaagagggttcttgaacctctgggcctggttgaggaacctgttaagacggctccgggaaaaaagaggccggtag

Important updates waiting for you!

Enter your email address below and subscribe to our newsletter

Enter your email to receive a coupon code for a 15% discount on catalog lentiviruses

This field is required

Unlock a special treat of savings waiting just for you! 🎁

Unlock exclusive deals awaiting you

Your exclusive code is ready! Copy it now!

Get 20% off now for all pre-made LVs