Skip to content

Adeno-associated Virus (AAV)

Tips and tricks for performing ddPCR

Clean everything You must have a clean working area to titer your AAV by ddPCR. Droplet digital PCR is a sensitive assay, so cross contamination into a no template control […]

Membrane Information

Polytetrafluoroethylene (PTFE)Hydrophobic membrane. Resistant to organic solvents as well as strong acids and bases. Low protein binding. Low in extractables. Main applications are the filtration of non-aqueous samples. Prior to […]

qPCR Determination of Mycoplasma in AAV Samples

Generate primers are designed to amplify the mycoplasma 16S rDNA via qPCR. Primer sequence:16S U1 (forward) 5’–GTTTGATCCTGGCTCAGGAYDAAC– 3’ **16S U8 (reverse) 5’–GAAAGGAGGTRWTCCAYCCSCAC– 3’ *** Y = C or T; D […]

AAV10 VP1 Sequence

atggctgctgacggttatcttccagattggctcgaggacaacctctctgagggcattcgcgagtggtgggacctgaaacctggagcccccaagcccaaggccaaccagcagaagcaggacgacggccggggtctggtgcttcctggctacaagtacctcggacccttcaacggactcgacaagggggagcccgtcaacgcggcggacgcagcggccctcgagcacgacaaggcctacgaccagcagctcaaagcgggtgacaatccgtacctgcggtataaccacgccgacgccgagtttcaggagcgtctgcaagaagatacgtcttttgggggcaacctcgggcgagcagtcttccaggccaagaagcgggttctcgaacctctcggtctggttgaggaagctgctaagacggctcctggaaagaagagaccggtagaaccgtcacctcagcgttcccccgactcctccacgggcatcggcaagaaaggccagcagcccgctaaaaagagactgaactttgggcagactggcgagtcagagtcagtccccgaccctcaaccaatcggagaaccaccagcaggcccctctggtctgggatctggtacaatggctgcaggcggtggcgctccaatggcagacaataacgaaggcgccgacggagtgggtagttcctcaggaaattggcattgcgattccacatggctgggcgacagagtcatcaccaccagcacccgaacctgggccctgcccacctacaacaaccacctctacaagcaaatctccaacgggacatcgggaggaagcaccaacgacaacacctacttcggctacagcaccccctgggggtattttgacttcaacagattccactgccacttctcaccacgtgactggcagcgactcatcaacaacaactggggattccggccaaaaagactcagcttcaagctcttcaacatccaggtcaaggaggtcacgcagaatgaaggcaccaagaccatcgccaataaccttaccagcacgattcaggtatttacggactcggaataccagctgccgtacgtcctcggctccgcgcaccagggctgcctgcctccgttcccggcggatgtcttcatgattccccagtacggctacctgacactgaacaatggaagtcaagccgtaggccgttcctccttctactgcctggaatattttccatctcaaatgctgcgaactggaaacaattttgaattcagctacaccttcgaggacgtgcctttccacagcagctacgcacacagccagagcttggaccgactgatgaatcctctcattgaccagtacctgtactacttatccagaactcagtccacaggaggaactcaaggtacccagcaattgttattttctcaagctgggcctgcaaacatgtcggctcaggccaagaactggctgcctggaccttgctaccggcagcagcgagtctccacgacactgtcgcaaaacaacaacagcaactttgcttggactggtgccaccaaatatcacctgaacggaagagactctctggtgaatcccggtgtcgccatggcaacccacaaggacgacgaggaacgcttcttcccgtcgagcggagtcctgatgtttggaaaacagggtgctggaagagacaatgtggactacagcagcgttatgctaacaagcgaagaagaaattaaaaccactaaccctgtagccacagaacaatacggcgtggtggctgacaacttgcagcaagccaatacagggcctattgtgggaaatgtcaacagccaaggagccttacctggcatggtctggcagaaccgagacgtgtacctgcagggtcccatctgggccaagattcctcacacggacggcaactttcacccgtctcctctgatgggcggctttggacttaaacacccgcctccacagatcctgatcaagaacacgccggtacctgcggatcctccaacaacgttcagccaggcgaaattggcttccttcatcacgcagtacagcaccggacaggtcagcgtggaaatcgagtgggagctgcagaaggagaacagcaaacgctggaacccagagattcagtacacttcaaactactacaaatctacaaatgtggactttgctgtcaatacagagggaacttattctgagcctcgccccattggtactcgttatctgacacgtaatctgtaa

Human ChAT Promoter

cccgggagcagggggtggggaaggaggagcagtggctggtggcaagtctgagccaggacatagccgatgacagcctgtgaatgaccggccagactggggttggaccttcggggcagagcaggcagcccttggaaagccaggctggtaggagcatgggtgggaggcacaaaacacagacaaacagacatatatacacatatatcctctaggcatctccgaggagtgatggaggagagagttggtaggtgggaccacaggaaaccatcccacccagctctgccttcttcaagctcagggtccctgaagcctgactagtgtctcccgaatgggggaggggggggctctgggcagagcaaaaggaggcattggctgcatgtcttagggcctttaccaactgaccttgtccttgctgtcctctcaaaagactgccatgctccggtgaatcctcaccaggacgccacctctttcactttgcagttgggggcagcccctacgaacccacagcactgggaggcgtgggaacaagcctgtggagagtgtccctgcactgtgccagcaagggctttacattctctgcccagcactgcaaggcagccccaggctcctccatccttgggcctggttcatccatctttctggactctctgttcctggcaacaaccctgccagtcccgatacatgggcggtgcttgcctctgggtaggggtggtgttgggtggggagaggggtgaggaaattagctaaacctcagctttagacttgagagaatagagggtgggctggtggaaaacatgagtatgtgcctgtggaggcttaggttcagggggatctcagagggtagcaattgtgacccacagcctaataataacagtctttgccctcttggcctggctc