agcagtgatgtcataatgatgtaatgcttattgtcacgcgatagttaatgattaacagtcatgtgatgtgttttatccaataggaagaaagcgcgcgtatgagttctcgcgagacttccggggtataaaagaccgagtgaacgagcccgccgccattctttgctctggactgctagaggaccctcgctgcc
Recent Posts
- rtTA(1st Gen), rtTA -advanced (2nd Gen)and Tet-On(3Gen)
- AAV(9-ENT)-CMV-GFP for Endothelial Cell Specific Transduction
- P7 Promoter of AAV Serotype 5
- AAV5 P41 vs AAV2 P40 Promoters
- Cis-Acting Elements and Trans-Acting Factors on AAV2 Promoters
- Strength of AAV P5, P19 and P40 Promoters in Serotype 2
- AAV9-Syn-GRAB-ATP1.0, Ready to Package for ATP Sensor Expression in Neurons
- What is the Linear Range of RLU for an Luminometer?
- TetR vs rTetR
- AAV(LK03)-CMV-NULL, AAV(AM)-CMV-NULL, AAV(LK03)-CMV-GFP and AAV(AM)-CMV-GFP, Ready to Package
- Role of MAAP in rAAV Biology & Production
- AAV9-CAG-GFP-miR183 Ready to Package
- How to Extract a Protein from Inclusion Body?
- How does imidazole affect my quantitation of protein?
- AAV NP84 VP1 Gene Amino Acid Sequence
- AAV NP59 VP1 Gene Amino Acid Sequence
- AAV NP40 VP1 Gene Amino Acid Sequence
- Early E1A Gene from Human Adenovirus Serotype 5
- AAV Rep Protein Functions
- pUCmini-iCAP AAV Capsid Plasmid
- MAAP Sequence of AAV2
- What is MAAP in AAV?
- AAV5 P41 Promoter
- How many AAV particles can be made in one HEK293T cell?
- Splice Donor and Acceptor Sites
- AAV(PHP.eB)-mGAD65-GFP and AAV(PHP.eB)-mDLX-GFP Ready to Package to Transduce GABAergic Interneurons.
- AAV Rh32.33 VP1 Gene
- AAVhu68-CMV-GFP and AAVhu68-CAG-fLuc Ready to Package
- Deletion of the B-B’ or C-C’ in AAV ITR has a minimal impact on AAV production but increases transgene expression
- How Does pH Affect DNA Stability?
- AAV(2-Retro)-Syn-axon-GCaMP6s Ready to Pacakge
- What is pH Value of ddH2O?
- Liver-detargeted AAV(9.61)-CMV-GFP Ready to Package for Specific Heart and Smooth Muscle Transductoin
- Liver-detargeted AAV(9.45)-CMV-GFP Ready to Package for Specific Heart and Smooth Muscle Transductoin
- AAV(BI-hTFR1)-CMV-GFP Ready to Package for Brain-wide Gene Delivery
- How many adenovirus particles can be made in one HEK293 cell?