Skip to content

Monthly Archives: July 2025

AAV Rep Protein Functions

AAV (Adeno-associated virus) encodes four non-structural proteins, Rep78, Rep68, Rep52, and Rep40, which are involved in different stages of the viral life cycle. Rep78 and Rep68 primarily regulate viral DNA replication, gene expression, […]

pUCmini-iCAP AAV Capsid Plasmid

In the pUCmini-iCAP capsid plasmid, the components tTA (or rrTA, tetracycline-controlled transactivator) and the TRE (tetracycline response element), which contains TetO (Tet operator) sequences, are key elements of a Tet-On inducible gene expression system designed […]

MAAP Sequence of AAV2

ctggcccaccaccaccaaagcccgcagagcggcataaggacgacagcaggggtcttgtgcttcctgggtacaagtacctcggacccttcaacggactcgacaagggagagccggtcaacgaggcagacgccgcggccctcgagcacgacaaagcctacgaccggcagctcgacagcggagacaacccgtacctcaagtacaaccacgccgacgcggagtttcaggagcgccttaaagaagatacgtcttttgggggcaacctcggacgagcagtcttccaggcgaaaaagagggttcttgaacctctgggcctggttgaggaacctgttaagacggctccgggaaaaaagaggccggtag

What is MAAP in AAV?

The Membrane-Associated Accessory Protein (MAAP) is a small viral protein encoded by the AAV cap gene that plays a crucial role in the extracellular secretion of AAV particles. It facilitates AAV egress by promoting […]

AAV5 P41 Promoter

tgttcaaatttgaactgactaagcggctcccgccagattttggcaagattactaagcaggaagtcaaggacttttttgcttgggcaaaggtcaatcaggtgccggtgactcacgagtttaaagttcccagggaattggcgggaactaaaggggcggagaaatctctaaaacgcccactgggtgacgtcaccaatactagctataaaagtctggagaagcgggccaggctctcatttgttcccgagacgcctcgcagttcagacgtgactgttgatcccgctcctctgcgaccgct

Splice Donor and Acceptor Sites

Splice donor and acceptor sites are specific nucleotide sequences that define the boundaries between exons and introns during RNA splicing. Donor sites, located at the 5′ end of an intron (exon-intron boundary), […]