Service Quote Request
Please fill out the form below with your detailed inquiry.
-
PHONE: 1-866-918-6812
Month July 2025
AAV Rep Protein Functions
AAV (Adeno-associated virus) encodes four non-structural proteins, Rep78, Rep68, Rep52, and Rep40, which are involved…
pUCmini-iCAP AAV Capsid Plasmid
In the pUCmini-iCAP capsid plasmid, the components tTA (or rrTA, tetracycline-controlled transactivator) and the TRE (tetracycline response…
MAAP Sequence of AAV2
ctggcccaccaccaccaaagcccgcagagcggcataaggacgacagcaggggtcttgtgcttcctgggtacaagtacctcggacccttcaacggactcgacaagggagagccggtcaacgaggcagacgccgcggccctcgagcacgacaaagcctacgaccggcagctcgacagcggagacaacccgtacctcaagtacaaccacgccgacgcggagtttcaggagcgccttaaagaagatacgtcttttgggggcaacctcggacgagcagtcttccaggcgaaaaagagggttcttgaacctctgggcctggttgaggaacctgttaagacggctccgggaaaaaagaggccggtag
What is MAAP in AAV?
The Membrane-Associated Accessory Protein (MAAP) is a small viral protein encoded by the AAV cap…
AAV5 P41 Promoter
tgttcaaatttgaactgactaagcggctcccgccagattttggcaagattactaagcaggaagtcaaggacttttttgcttgggcaaaggtcaatcaggtgccggtgactcacgagtttaaagttcccagggaattggcgggaactaaaggggcggagaaatctctaaaacgcccactgggtgacgtcaccaatactagctataaaagtctggagaagcgggccaggctctcatttgttcccgagacgcctcgcagttcagacgtgactgttgatcccgctcctctgcgaccgct
How many AAV particles can be made in one HEK293T cell?
A single HEK293T cell can produce a wide range of adeno-associated virus (AAV) particles,…
Splice Donor and Acceptor Sites
Splice donor and acceptor sites are specific nucleotide sequences that define the boundaries between exons…
Important updates waiting for you!
Enter your email address below and subscribe to our newsletter