AAV (Adeno-associated virus) encodes four non-structural proteins, Rep78, Rep68, Rep52, and Rep40, which are involved in different stages of the viral life cycle. Rep78 and Rep68 primarily regulate viral DNA replication, gene expression, […]
Monthly Archives: July 2025
pUCmini-iCAP AAV Capsid Plasmid
In the pUCmini-iCAP capsid plasmid, the components tTA (or rrTA, tetracycline-controlled transactivator) and the TRE (tetracycline response element), which contains TetO (Tet operator) sequences, are key elements of a Tet-On inducible gene expression system designed […]
MAAP Sequence of AAV2
ctggcccaccaccaccaaagcccgcagagcggcataaggacgacagcaggggtcttgtgcttcctgggtacaagtacctcggacccttcaacggactcgacaagggagagccggtcaacgaggcagacgccgcggccctcgagcacgacaaagcctacgaccggcagctcgacagcggagacaacccgtacctcaagtacaaccacgccgacgcggagtttcaggagcgccttaaagaagatacgtcttttgggggcaacctcggacgagcagtcttccaggcgaaaaagagggttcttgaacctctgggcctggttgaggaacctgttaagacggctccgggaaaaaagaggccggtag
What is MAAP in AAV?
The Membrane-Associated Accessory Protein (MAAP) is a small viral protein encoded by the AAV cap gene that plays a crucial role in the extracellular secretion of AAV particles. It facilitates AAV egress by promoting […]
AAV5 P41 Promoter
tgttcaaatttgaactgactaagcggctcccgccagattttggcaagattactaagcaggaagtcaaggacttttttgcttgggcaaaggtcaatcaggtgccggtgactcacgagtttaaagttcccagggaattggcgggaactaaaggggcggagaaatctctaaaacgcccactgggtgacgtcaccaatactagctataaaagtctggagaagcgggccaggctctcatttgttcccgagacgcctcgcagttcagacgtgactgttgatcccgctcctctgcgaccgct
How many AAV particles can be made in one HEK293T cell?
A single HEK293T cell can produce a wide range of adeno-associated virus (AAV) particles, typically in the range of 10,000 to 100,000 vector genomes per cell. The exact number varies depending on […]
Splice Donor and Acceptor Sites
Splice donor and acceptor sites are specific nucleotide sequences that define the boundaries between exons and introns during RNA splicing. Donor sites, located at the 5′ end of an intron (exon-intron boundary), […]