Service Quote Request
Please fill out the form below with your detailed inquiry.
-
PHONE: 1-866-918-6812
Year 2025
P7 Promoter of AAV Serotype 5
agcagtgatgtcataatgatgtaatgcttattgtcacgcgatagttaatgattaacagtcatgtgatgtgttttatccaataggaagaaagcgcgcgtatgagttctcgcgagacttccggggtataaaagaccgagtgaacgagcccgccgccattctttgctctggactgctagaggaccctcgctgcc
AAV5 P41 vs AAV2 P40 Promoters
The P41 and 40 promoters are the capsid gene promoters of different Adeno-Associated Virus…
Cis-Acting Elements and Trans-Acting Factors on AAV2 Promoters
The three promoters are functionally interconnected through their shared regulatory elements, leading to the…
Strength of AAV P5, P19 and P40 Promoters in Serotype 2
The AAV serotype 2 promoters P5, P19, and P40 exhibit a distinct hierarchy of…
What is the Linear Range of RLU for an Luminometer?
1. Typical linear ranges 2. How to determine linear range experimentally 3. Practical notes
TetR vs rTetR
TetR (Tetracycline Repressor) rTetR (reverse TetR) Summary Table Feature TetR rTetR (reverse TetR) Binds…
Important updates waiting for you!
Enter your email address below and subscribe to our newsletter