Service Quote Request
Please fill out the form below with your detailed inquiry.
-
PHONE: 1-866-918-6812
Year 2022
Tips for Maximizing Ligation Efficiencies
T4 DNA Ligase is the most extensively used ligase for cloning-based experiments. Traditionally, a…
Troubles with ligation?
Check the activity of your T4 DNA Ligase with two easy-to-do control experiments You…
Electroporation vs. Heat Shock Transformation
The advantages of using electroporation are the higher efficiency, more colonies, and much faster…
Lentivirus Formulation Buffer
20 mM PIPES, 75 mM NaCI, 2.5% sucrose, pH 6.520 mM HEPES, 75 mM…
A195 Buffer for Adenovirus Formulation and Long Term Storage
10 mM Tris-HCl, 10 mM histidine, 75 mM NaCl, 5% sucrose (w/v), 1 mM…
DNA/RNA non-specific endonuclease [Serratia marcescens]
atgcgctttaacaacaagatgttggccctggccgccctgctgttcgccgcacaggcgtcggccgacacgttcgaatccatcgacaactgcgcggtcggctgcccgaccggcggcagcagcaacgtgtcgatcgtgcgtcatgcttatacgttgaacaacaacagcacaaccaagttcgccaactgggtggcctatcacatcaccaaagacacgccggccagcggcaagacgcgcaactggaaaaccgacccggcgctcaatccggccgacaccctggcgcccgccgattacaccggcgccaacgcggcgctgaaggtcgatcgcggtcatcaggcgccgctggcctcgctggcgggcgtttccgactgggaatcgctgaactacctgtccaacatcacgccgcaaaagtccgatcttaaccagggcgcctgggcgcggctggaagatcaggaacgcaagctgatcgatcgcgccgacatctcctcggtctataccgtgaccgggccgttgtatgagcgtgatatgggcaaactgccgggcacccagaaagcgcacaccatccccagcgcctactggaaggtgattttcatcaacaacagcccggcggtaaaccactatgccgctttcctgttcgatcagaacacgccgaagggcgccgatttctgccaattccgcgtgacggtggacgagatcgagaaacgtaccggcctgatcatctgggccggtctgccggacgacgtacaggcttcgctgaagagcaagcccggcgtcctgccggagctgatgggctgcaaaaactga
Important updates waiting for you!
Enter your email address below and subscribe to our newsletter