Service Quote Request
Please fill out the form below with your detailed inquiry.
-
PHONE: 1-866-918-6812
Month September 2018
CRISPR/Cas9-based generation of knockdown mice by intronic insertion of artificial microRNA using longer single-stranded DNA
Knockdown mouse models, where gene dosages can be modulated, provide valuable insights into gene…
Validated SARM1 shRNA
5’CCGGCAAGGTCTATGCGATGCTATACTCGAGTATAGCATCGCATAGACCTTGTTTTTG 3’
Easi-CRISPR for creating knock-in and conditional knockout mouse models using long ssDNA donors
CRISPR/Cas9-based genome editing can easily generate knockout mouse models by disrupting the gene sequence,…
One-step generation of complete gene knockout mice and monkeys by CRISPR/Cas9-mediated gene editing with multiple sgRNAs
The CRISPR/Cas9 system is an efficient gene-editing method, but the majority of gene-edited animals…
CRISPR-EZ Video Protocol
CRISPR-EZ Video Protocol
Multiple sgRNAs with overlapping sequences enhance CRISPR/Cas9-mediated knock-in efficiency
Abstract The CRISPR/Cas9 system is widely applied in genome engineering due to its simplicity…
Tild-CRISPR Allows for Efficient and Precise Gene Knockin in Mouse and Human Cells
Abstract The targeting efficiency of knockin sequences via homologous recombination (HR) is generally low.…
CRISPR Genome Editing in Mice from He Lab at UC Berkeley
CRISPR-mediated mouse genome editing is typically accomplished by microinjection of Cas9 DNA/RNA and sgRNA…
Validated GPAM Target Region Sequence
Validated GPAM Target Region Sequence: GACGGAGGCTCGATGAAAC GACTGTGGGTTCAAACCTA
Important updates waiting for you!
Enter your email address below and subscribe to our newsletter